|
TaKaRa
3 smart seq cds primer iia 3 Smart Seq Cds Primer Iia, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/3 smart seq cds primer iia/product/TaKaRa Average 98 stars, based on 1 article reviews
3 smart seq cds primer iia - by Bioz Stars,
2026-06
98/100 stars
|
Buy from Supplier |
|
Toyobo
mena seq4 5 3 150 taccgtgattatttgtccgc primers Mena Seq4 5 3 150 Taccgtgattatttgtccgc Primers, supplied by Toyobo, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mena seq4 5 3 150 taccgtgattatttgtccgc primers/product/Toyobo Average 98 stars, based on 1 article reviews
mena seq4 5 3 150 taccgtgattatttgtccgc primers - by Bioz Stars,
2026-06
98/100 stars
|
Buy from Supplier |
|
Kuraray Noritake Dental
solvent acetone ceramic primer clearfil ceramic primer plus kuraray noritake 3 methacryloxypropyl trimethoxysilane Solvent Acetone Ceramic Primer Clearfil Ceramic Primer Plus Kuraray Noritake 3 Methacryloxypropyl Trimethoxysilane, supplied by Kuraray Noritake Dental, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/solvent acetone ceramic primer clearfil ceramic primer plus kuraray noritake 3 methacryloxypropyl trimethoxysilane/product/Kuraray Noritake Dental Average 86 stars, based on 1 article reviews
solvent acetone ceramic primer clearfil ceramic primer plus kuraray noritake 3 methacryloxypropyl trimethoxysilane - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Premier Biosoft
primer 3 plus Primer 3 Plus, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer 3 plus/product/Premier Biosoft Average 86 stars, based on 1 article reviews
primer 3 plus - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
PrimerDesign Inc
primer 3 plus Primer 3 Plus, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer 3 plus/product/PrimerDesign Inc Average 90 stars, based on 1 article reviews
primer 3 plus - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Biotechnology Information
primer-blast software version primer 3 plus Primer Blast Software Version Primer 3 Plus, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer-blast software version primer 3 plus/product/Biotechnology Information Average 90 stars, based on 1 article reviews
primer-blast software version primer 3 plus - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer 3 plus Primer 3 Plus, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer 3 plus/product/Sangon Biotech Average 90 stars, based on 1 article reviews
primer 3 plus - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |